Command line: [exonerate -m p2g --showtargetgff -q SELENOM.x.fa -t SELENOM.extraction.KV884744.1.fa] Hostname: [sitdoc] C4 Alignment: ------------ Query: SELENOM # Protein # Selenoprotein M (SELENOM) # Zebrafish Target: KV884744.1:subseq(2341062,100000) Monopterus albus unplaced genomic scaffold scaffold56.1, whole genome shotgun sequence:[revcomp] Model: protein2genome:local Raw score: 468 Query range: 0 -> 126 Target range: 52292 -> 49862 1 : LeuIlePheThrAlaLeuLeuProSerValIleLeuThrTyrGluValAsnIleGluLys : 20 |||||| ! !||| !|||! !..! ! !! !.!!|||!!:|||:!!:!::!!||| LeuIleValLeuAlaSerLeuLeuGlnCysAlaSerAlaTyrAspValAspLeuLysLys 52292 : CTGATCGTGTTGGCCAGTTTACTTCAGTGCGCCTCGGCCTACGACGTGGATCTGAAGAAA : 52235 21 : LeuSerGlyLeuAlaArgAlaArgValGlu >>>> Target Intron 1 >>>> T : 31 |||..!|||||||||!:!|||||||||||| 779 bp | LeuAspGlyLeuAlaLysAlaArgValGlu++ ++T 52234 : CTGGACGGGCTCGCAAAAGCGAGGGTGGAGgt.........................agA : 51423 32 : hrCysGlyGlyUnkGlnLeuAsnArgMetArgGlu >>>> Target Intron 2 >> : 43 ||||||||||| ||||||||||||:!:|||||| 156 bp hrCysGlyGly***GlnLeuAsnArgLeuArgGlu++ 51422 : CATGTGGTGGATGACAGCTGAACAGGCTCAGAGAGgt....................... : 51385 44 : >> ValLysAlaPheValThrGlnAspIleProLeu{Ty} >>>> Target Intro : 54 |||||||||||||||..!|||||||||||||||{||} 862 bp ++ValLysAlaPheValValGlnAspIleProLeu{Ty}++ 51384 : ..agGTCAAAGCCTTTGTGGTCCAGGATATTCCTCTG{TA}gt................. : 51194 55 : n 3 >>>> {r}HisAsnLeuValMetLysHisIleProGlyAlaAspProGluLeuVa : 70 {|}||||||||||||||||||||||||||||||||||||||||||||||| ++{r}HisAsnLeuValMetLysHisIleProGlyAlaAspProGluLeuVa 51193 : ........ag{C}CATAACCTGGTGATGAAGCACATTCCTGGGGCCGACCCTGAGCTTGT : 50288 71 : lLeuLeuAsnHisTyrTyrGluGluLeuAsp >>>> Target Intron 4 >>>> : 81 ||||||||||||||||||||||||||||||| 255 bp lLeuLeuAsnHisTyrTyrGluGluLeuAsp++ ++ 50287 : CCTCCTGAACCATTATTATGAAGAGTTGGATgt.........................ag : 50002 82 : ArgIleProLeuSerGluMetThrArgAlaGluIleAsnLysLeuLeuAlaGluLeuGly : 100 |||||||||||||||!!:|||||||||:!!||||||||| ||||||!.!.!.|||||| ArgIleProLeuSerAspMetThrArgSerGluIleAsnAlaLeuLeuGlyAsnLeuGly 50001 : CGGATTCCCCTGTCTGACATGACCCGCTCTGAGATTAACGCTCTCCTGGGGAACCTGGGT : 49943 101 : PheTyrLysLysAspHisProGluAspGlnValProGluGluPheArgPheSerProAla : 120 ||||||||||||! !!!.|||||||||:!!|||||||||||||||||||||||||||||| PheTyrLysLysAlaGlnProGluAspGluValProGluGluPheArgPheSerProAla 49942 : TTCTATAAGAAGGCTCAACCTGAGGATGAGGTGCCAGAGGAGTTCCGCTTCTCTCCTGCC : 49883 121 : LysAspSerProPheGlu : 126 |||||||||||||||:!! LysAspSerProPheLys 49882 : AAAGACAGCCCATTTAAA : 49863 vulgar: SELENOM 0 126 . KV884744.1:subseq(2341062,100000) 52292 49862 - 468 M 30 90 5 0 2 I 0 775 3 0 2 M 12 36 5 0 2 I 0 152 3 0 2 M 11 33 S 0 2 5 0 2 I 0 858 3 0 2 S 1 1 M 26 78 5 0 2 I 0 251 3 0 2 M 46 138 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-23 ##type DNA # # # seqname source feature start end score strand frame attributes # KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local gene 49863 52292 468 - . gene_id 1 ; sequence SELENOM ; gene_orientation + KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local cds 52203 52292 . - . KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local exon 52203 52292 . - . insertions 0 ; deletions 0 KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local splice5 52201 52202 . - . intron_id 1 ; splice_site "GT" KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local intron 51424 52202 . - . intron_id 1 KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local splice3 51424 51425 . - . intron_id 0 ; splice_site "AG" KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local cds 51388 51423 . - . KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local exon 51388 51423 . - . insertions 0 ; deletions 0 KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local splice5 51386 51387 . - . intron_id 2 ; splice_site "GT" KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local intron 51232 51387 . - . intron_id 2 KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local splice3 51232 51233 . - . intron_id 1 ; splice_site "AG" KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local cds 51197 51231 . - . KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local exon 51197 51231 . - . insertions 0 ; deletions 0 KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local splice5 51195 51196 . - . intron_id 3 ; splice_site "GT" KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local intron 50335 51196 . - . intron_id 3 KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local splice3 50335 50336 . - . intron_id 2 ; splice_site "AG" KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local cds 50256 50334 . - . KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local exon 50256 50334 . - . insertions 0 ; deletions 0 KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local splice5 50254 50255 . - . intron_id 4 ; splice_site "GT" KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local intron 50001 50255 . - . intron_id 4 KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local splice3 50001 50002 . - . intron_id 3 ; splice_site "AG" KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local cds 49863 50000 . - . KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local exon 49863 50000 . - . insertions 0 ; deletions 0 KV884744.1:subseq(2341062,100000) exonerate:protein2genome:local similarity 49863 52292 468 - . alignment_id 1 ; Query SELENOM ; Align 52293 1 90 ; Align 51424 31 36 ; Align 51232 43 33 ; Align 50334 55 78 ; Align 50001 81 138 # --- END OF GFF DUMP --- # -- completed exonerate analysis