Command line: [exonerate --exhaustive yes -m p2g --showtargetgff -q /export/home/u114420/treball/fastas/GP4b.x.fa -t GP4b.extraction.KV884860.1.fa] Hostname: [sitdoc] C4 Alignment: ------------ Query: GP4b Protein # Glutathione peroxidase 4b (GPx4b) # Zebrafish Target: KV884860.1:subseq(1080868,100000) Monopterus albus unplaced genomic scaffold scaffold172.1, whole genome shotgun sequence Model: protein2genome:local Raw score: 591 Query range: 0 -> 130 Target range: 40632 -> 51128 1 : Phe{Ar} >>>> Target Intron 1 >>>> {g}GlyTyrValCysIleIleThr : 9 |||{||} 8905 bp {|}|||!:!||||||||||||..! Phe{Ar}++ ++{g}GlyPheValCysIleIleVal 40633 : TTC{AG}gt.........................ag{G}GGATTTGTGTGCATCATAGTA : 49562 10 : AsnValAlaSerLysUnkGlyLysThrProValAsnTyrThrGlnLeuAlaAlaMetHis : 29 ||||||||||||||| ||||||||| !|||||||||||||||||||||!.!|||||| AsnValAlaSerLys***GlyLysThrLysValAsnTyrThrGlnLeuAlaGlyMetHis 49563 : AATGTAGCCTCTAAATGAGGAAAGACCAAAGTAAACTACACTCAGCTAGCGGGAATGCAC : 49622 30 : ValThrTyrAlaGluLysGlyLeuArgIleLeuGlyPheProCysAsnGlnPheGlyLys : 49 !.!:!!||||||!!:|||||||||||||||||||||||||||||||||||||||||| ! AlaSerTyrAlaAspLysGlyLeuArgIleLeuGlyPheProCysAsnGlnPheGlyGly 49623 : GCCTCCTATGCTGATAAAGGTTTACGCATCCTGGGCTTCCCATGCAACCAGTTTGGAGGA : 49682 50 : Gln >>>> Target Intron 2 >>>> GluProGlySerGluAlaGluIleLysG : 60 ||| 315 bp |||||||||!!!|||||||||||||||| Gln++ ++GluProGlyThrGluAlaGluIleLysG 49683 : CAGgt.........................agGAGCCAGGGACTGAAGCAGAGATTAAAG : 50030 61 : luPheAlaLysGlyTyrAsnAlaGluPheAspLeuPheSerLysIleAspValAsnGlyA : 80 |||||||||||||||||||||||||||||||||||||||||||||||!!:|||||||||| luPheAlaLysGlyTyrAsnAlaGluPheAspLeuPheSerLysIleGluValAsnGlyA 50031 : AGTTTGCCAAAGGTTATAATGCTGAGTTTGACCTCTTCAGTAAGATTGAGGTGAATGGAG : 50090 81 : spAlaAlaHisProLeuTrpLysTrpMetLysGluGlnProLysGlyArgGlyThrLeuG : 100 || !|||||||||||||||||||||||||||! !||||||||||||||||||||||||| spAsnAlaHisProLeuTrpLysTrpMetLysAlaGlnProLysGlyArgGlyThrLeuG 50091 : ATAATGCTCACCCTCTTTGGAAGTGGATGAAGGCACAGCCCAAAGGCAGAGGGACCCTGG : 50150 101 : ly{As} >>>> Target Intron 3 >>>> {n}AsnIleLysTrpAsnPheThrL : 109 ||{||} 433 bp {|}|||||||||||||||||||||| ly{As}++ ++{n}AsnIleLysTrpAsnPheThrL 50151 : GA{AA}gt.........................ag{t}aATATAAAGTGGAACTTCACAA : 50610 110 : ys >>>> Target Intron 4 >>>> PheLeuIleAspArgGluGlyGlnValVa : 119 || 453 bp |||||||||:!!||||||||||||||||| ys++ ++PheLeuIleAsnArgGluGlyGlnValVa 50611 : AGgt.........................agTTTCTTATAAACAGAGAAGGACAAGTGGT : 51093 120 : lLysArgTyrGlyProMetAspAspProSerVal : 130 ||||||||||||||||! !!:|||||||||||| lLysArgTyrGlyProThrGluAspProSerVal 51094 : GAAGAGATATGGTCCAACAGAGGATCCCAGTGTA : 51128 vulgar: GP4b 0 130 . KV884860.1:subseq(1080868,100000) 40632 51128 + 591 M 1 3 S 0 2 5 0 2 I 0 8901 3 0 2 S 1 1 M 48 144 5 0 2 I 0 311 3 0 2 M 50 150 S 0 2 5 0 2 I 0 429 3 0 2 S 1 1 M 8 24 5 0 2 I 0 449 3 0 2 M 21 63 # --- START OF GFF DUMP --- # # ##gff-version 2 ##source-version exonerate:protein2genome:local 2.2.0 ##date 2017-11-22 ##type DNA # # # seqname source feature start end score strand frame attributes # KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local gene 40633 51128 591 + . gene_id 1 ; sequence GP4b ; gene_orientation + KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local cds 40633 40637 . + . KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local exon 40633 40637 . + . insertions 0 ; deletions 0 KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local splice5 40638 40639 . + . intron_id 1 ; splice_site "GT" KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local intron 40638 49542 . + . intron_id 1 KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local splice3 49541 49542 . + . intron_id 0 ; splice_site "AG" KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local cds 49543 49687 . + . KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local exon 49543 49687 . + . insertions 0 ; deletions 0 KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local splice5 49688 49689 . + . intron_id 2 ; splice_site "GT" KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local intron 49688 50002 . + . intron_id 2 KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local splice3 50001 50002 . + . intron_id 1 ; splice_site "AG" KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local cds 50003 50154 . + . KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local exon 50003 50154 . + . insertions 0 ; deletions 0 KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local splice5 50155 50156 . + . intron_id 3 ; splice_site "GT" KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local intron 50155 50587 . + . intron_id 3 KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local splice3 50586 50587 . + . intron_id 2 ; splice_site "ag" KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local cds 50588 50612 . + . KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local exon 50588 50612 . + . insertions 0 ; deletions 0 KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local splice5 50613 50614 . + . intron_id 4 ; splice_site "GT" KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local intron 50613 51065 . + . intron_id 4 KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local splice3 51064 51065 . + . intron_id 3 ; splice_site "AG" KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local cds 51066 51128 . + . KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local exon 51066 51128 . + . insertions 0 ; deletions 0 KV884860.1:subseq(1080868,100000) exonerate:protein2genome:local similarity 40633 51128 591 + . alignment_id 1 ; Query GP4b ; Align 40633 1 3 ; Align 49544 3 144 ; Align 50003 51 150 ; Align 50589 102 24 ; Align 51066 110 63 # --- END OF GFF DUMP --- # -- completed exonerate analysis