genewise output Score 18.65 bits over entire alignment Scores as bits over a synchronous coding model Warning: The bits scores is not probablistically correct for single seqs See WWW help for more info SPP00000017_1.0 126 PEYVWAPAKPPEET P + W P PP T PSWAWGPRPPPAPT GL841643.1 7301 cttgtgcacccgca ccgcggcgcccccc ctgagccgccaccc // >GL841643.1.pep PSWAWGPRPPPAPT // >GL841643.1.[7301:7342].sp CCCTCTTGGGCATGGGGCCCCAGGCCCCCCCCAGCCCCCACC // GL841643.1 GeneWise match 7301 7342 18.65 + . GL841643.1-genewise-prediction-1 GL841643.1 GeneWise cds 7301 7342 0.00 + 0 GL841643.1-genewise-prediction-1 // genewise output Score 110.67 bits over entire alignment Scores as bits over a synchronous coding model Warning: The bits scores is not probablistically correct for single seqs See WWW help for more info SPP00000017_1.0 55 EVKAFVTQDIPF HNLVMKHLPGA +VK FVTQD+P+ HNLV+K+ PGA QVKLFVTQDVPY Y:Y[tat] HNLVLKYFPGA GL841643.1 -27347 cgactgacggctTAGTATCTT Intron 1 CAGTcacgcattcgg atatttcaatca <2-----[27309:26770]-2> aatttaatcgc ggatcccgttac ccgggacctac SPP00000017_1.0 79 DPELVLLGRRYEELE RIPLSEMTREE DPELVLLG +YEELE RIPL +MTREE DPELVLLGYQYEELE RIPLRDMTREE GL841643.1 -26735 gcgcgccgtctggcgGTGAGTC Intron 2 CAGaacccgaacgg acattttgaaaaata<0-----[26690:26578]-0>gtctgatcgaa ctggcggacgtggag accctcgcggg SPP00000017_1.0 105 INALVQELGFYRKAAPDAQVPPEYVWAPAK IN L+++LGFYRK++PDA VPPE+ +APA+ INQLLKDLGFYRKSSPDAPVPPEFQYAPAR GL841643.1 -26544 aacccagcgttcatacggcgccgtctgcga taattaatgtagacgcacctccataacccg ctggggcgcccgaccgtccctcgcgccccg // Making a Y in phase 2 intron >GL841643.1.pep QVKLFVTQDVPYYHNLVLKYFPGADPELVLLGYQYEELERIPLRDMTREEINQLLKDLGF YRKSSPDAPVPPEFQYAPAR // >GL841643.1.[27347:26453].sp CAGGTGAAACTTTTCGTCACCCAGGATGTTCCATACTATCACAACCTGGTGCTGAAATAC TTCCCTGGAGCCGACCCTGAGCTGGTCCTGCTGGGATACCAGTATGAGGAGCTAGAGAGA ATCCCCCTCCGTGACATGACCCGGGAGGAGATCAATCAGCTGCTGAAGGACCTGGGCTTC TACCGGAAATCCAGCCCGGATGCCCCCGTCCCTCCCGAGTTCCAGTACGCCCCCGCCAGG // GL841643.1 GeneWise match 27347 26455 110.67 - . GL841643.1-genewise-prediction-1 GL841643.1 GeneWise cds 27347 27310 0.00 - 0 GL841643.1-genewise-prediction-1 GL841643.1 GeneWise intron 27309 26770 0.00 - . GL841643.1-genewise-prediction-1 GL841643.1 GeneWise cds 26769 26691 0.00 - 1 GL841643.1-genewise-prediction-1 GL841643.1 GeneWise intron 26690 26578 0.00 - . GL841643.1-genewise-prediction-1 GL841643.1 GeneWise cds 26577 26455 0.00 - 0 GL841643.1-genewise-prediction-1 //